Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KCNAB2 cdna clone

KCNAB2 cDNA Clone

Gene Names
KCNAB2; AKR6A5; KCNA2B; HKvbeta2; KV-BETA-2; HKvbeta2.1; HKvbeta2.2
Synonyms
KCNAB2; KCNAB2 cDNA Clone; KCNAB2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtatccagaatcaacgacgggctccccggctcggctctcgctgcggcagacgggctcccccgggatgatctacagtactcggtatgggagtcccaaaagacagctccagttttacaggaacctgggcaagtctggcctgcgggtctcctgcctgggacttggaacatgggtgaccttcggaggccagatcaccgatgagatggcagagcagctcatgaccttggcctatgataatggcatcaacctcttcgatacagcagaagtctacgcagccggcaaggctgaagtggtactgggaaacatcattaagaagaaaggatggaggcggtccagcctcgtcatcaccaccaagatcttctggggcggaaaggcggagacggagcggggcctgtccaggaagcacataatcgaaggtctgaaagcttccctggagcgactgcagctggagtacgtggatgtggtgtttgccaaccgcccggaccccaacaccccgatggaagagaccgtccgcgccatgacccacgtcatcaaccaggggatggccatgtactggggcacgtcacgctggagctccatggagatcatggaggcctactccgtggcccggcagttcaacctgaccccgcccatctgcgagcaggctgagtaccacatgttccagcgtgagaaagtggaggtgcagctgccggagctgttccacaagataggagtgggcgccatgacctggtcccctctggcctgtggcattgtttctggcaagtacgacagtggcatcccaccctactcaagagcctccttgaagggctaccagtggctgaaggacaagatcctcagtgaggagggccggcgccagcaagccaagctgaaggagctgcaggccatcgccgagcgcctgggctgcaccctgccccagctggccatagcctggtgcctgaggaatgagggagtcagctccgtgctcctgggggcctccaatgcggaccagctcatggagaacattggggcaatacaggtccttccgaaactgtcgtcttccattatccacgagattgatagtattttgggcaataaaccctacagcaaaaaggactacagatcctaa
Sequence Length
1104
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,560 Da
NCBI Official Full Name
Homo sapiens potassium voltage-gated channel, shaker-related subfamily, beta member 2, mRNA
NCBI Official Synonym Full Names
potassium voltage-gated channel subfamily A regulatory beta subunit 2
NCBI Official Symbol
KCNAB2
NCBI Official Synonym Symbols
AKR6A5; KCNA2B; HKvbeta2; KV-BETA-2; HKvbeta2.1; HKvbeta2.2
NCBI Protein Information
voltage-gated potassium channel subunit beta-2
UniProt Protein Name
Voltage-gated potassium channel subunit beta-2
UniProt Gene Name
KCNAB2
UniProt Synonym Gene Names
KCNA2B; KCNK2; hKvbeta2
UniProt Entry Name
KCAB2_HUMAN

NCBI Description

Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member is one of the beta subunits, which are auxiliary proteins associating with functional Kv-alpha subunits. This member alters functional properties of the KCNA4 gene product. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Dec 2010]

Uniprot Description

Kv-beta2: Accessory potassium channel protein which modulates the activity of the pore-forming alpha subunit. Alters functional properties of Kv1.4. Forms heteromultimeric complex with alpha subunits. Forms a ternary complex with SQSTM1 and PRKCZ. Belongs to the shaker potassium channel beta subunit family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Channel, potassium

Chromosomal Location of Human Ortholog: 1p36.3

Cellular Component: cytosol; extrinsic to internal side of plasma membrane; membrane; microtubule; plasma membrane; voltage-gated potassium channel complex

Molecular Function: aldo-keto reductase activity; potassium channel regulator activity

Research Articles on KCNAB2

Similar Products

Product Notes

The KCNAB2 kcnab2 (Catalog #AAA1268558) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtatccag aatcaacgac gggctccccg gctcggctct cgctgcggca gacgggctcc cccgggatga tctacagtac tcggtatggg agtcccaaaa gacagctcca gttttacagg aacctgggca agtctggcct gcgggtctcc tgcctgggac ttggaacatg ggtgaccttc ggaggccaga tcaccgatga gatggcagag cagctcatga ccttggccta tgataatggc atcaacctct tcgatacagc agaagtctac gcagccggca aggctgaagt ggtactggga aacatcatta agaagaaagg atggaggcgg tccagcctcg tcatcaccac caagatcttc tggggcggaa aggcggagac ggagcggggc ctgtccagga agcacataat cgaaggtctg aaagcttccc tggagcgact gcagctggag tacgtggatg tggtgtttgc caaccgcccg gaccccaaca ccccgatgga agagaccgtc cgcgccatga cccacgtcat caaccagggg atggccatgt actggggcac gtcacgctgg agctccatgg agatcatgga ggcctactcc gtggcccggc agttcaacct gaccccgccc atctgcgagc aggctgagta ccacatgttc cagcgtgaga aagtggaggt gcagctgccg gagctgttcc acaagatagg agtgggcgcc atgacctggt cccctctggc ctgtggcatt gtttctggca agtacgacag tggcatccca ccctactcaa gagcctcctt gaagggctac cagtggctga aggacaagat cctcagtgag gagggccggc gccagcaagc caagctgaag gagctgcagg ccatcgccga gcgcctgggc tgcaccctgc cccagctggc catagcctgg tgcctgagga atgagggagt cagctccgtg ctcctggggg cctccaatgc ggaccagctc atggagaaca ttggggcaat acaggtcctt ccgaaactgt cgtcttccat tatccacgag attgatagta ttttgggcaa taaaccctac agcaaaaagg actacagatc ctaa. It is sometimes possible for the material contained within the vial of "KCNAB2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.