Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZNF434 cdna clone

ZNF434 cDNA Clone

Gene Names
ZSCAN32; HCCS-5; ZNF434
Synonyms
ZNF434; ZNF434 cDNA Clone; ZNF434 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgcagtgaagagtaccgaggcacacccatcctcaaacaaggatcccacacagggccagaaatcagccctccagggtaacagccctgactccgaggcctcccgtcagcgcttcaggcagttttgctaccaggaggtaactggcccacatgaagcttttagcaaactctgggaactctgttgtcagtggctgaggccgaagacccactcaaaagaggaaatcctggagctgctggttttggagcagtttctgactatcttgccagaggagatccagacctgggtgagggagcagcatccagaaaacggcgaggaagctgtggctctggttgaggatgtacagagagctcctggacaacaggttctagattctgagaaggacttgaaagtactcatgaaggagatggcccctttgggagcaaccagagaatcactgagatcccaatggaaacaggaggttcagccagaggaaccgacttttaagggatcacagagctcacaccaaagaccaggggaacagtcagaagcctggcttgctcctcaggctcccaggaacctgcctcaaaacacaggtctccacgaccaggagacaggtgctgtggtctggacagctgggtcccagggaccagccatgcgtgacaacagagctgtatccctctgtcagcaagaatggatgtgcccaggccctgcacaaagggccctctacaggggtgccacccagaggaaggacagtcacgtctcgctggcaacaggtgccctggggctatga
Sequence Length
771
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
46,222 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 434, mRNA
NCBI Official Synonym Full Names
zinc finger and SCAN domain containing 32
NCBI Official Symbol
ZSCAN32
NCBI Official Synonym Symbols
HCCS-5; ZNF434
NCBI Protein Information
zinc finger and SCAN domain-containing protein 32
UniProt Protein Name
Zinc finger and SCAN domain-containing protein 32
UniProt Gene Name
ZSCAN32
UniProt Synonym Gene Names
ZNF434; HCCS-5
UniProt Entry Name
ZSC32_HUMAN

Uniprot Description

ZNF434: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family.

Protein type: C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 16p13.3

Cellular Component: nucleus

Molecular Function: protein binding

Similar Products

Product Notes

The ZNF434 zscan32 (Catalog #AAA1268194) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgcag tgaagagtac cgaggcacac ccatcctcaa acaaggatcc cacacagggc cagaaatcag ccctccaggg taacagccct gactccgagg cctcccgtca gcgcttcagg cagttttgct accaggaggt aactggccca catgaagctt ttagcaaact ctgggaactc tgttgtcagt ggctgaggcc gaagacccac tcaaaagagg aaatcctgga gctgctggtt ttggagcagt ttctgactat cttgccagag gagatccaga cctgggtgag ggagcagcat ccagaaaacg gcgaggaagc tgtggctctg gttgaggatg tacagagagc tcctggacaa caggttctag attctgagaa ggacttgaaa gtactcatga aggagatggc ccctttggga gcaaccagag aatcactgag atcccaatgg aaacaggagg ttcagccaga ggaaccgact tttaagggat cacagagctc acaccaaaga ccaggggaac agtcagaagc ctggcttgct cctcaggctc ccaggaacct gcctcaaaac acaggtctcc acgaccagga gacaggtgct gtggtctgga cagctgggtc ccagggacca gccatgcgtg acaacagagc tgtatccctc tgtcagcaag aatggatgtg cccaggccct gcacaaaggg ccctctacag gggtgccacc cagaggaagg acagtcacgt ctcgctggca acaggtgccc tggggctatg a. It is sometimes possible for the material contained within the vial of "ZNF434, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.