Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NOB1 cdna clone

NOB1 cDNA Clone

Gene Names
NOB1; ART-4; NOB1P; MST158; MSTP158; PSMD8BP1
Synonyms
NOB1; NOB1 cDNA Clone; NOB1 cdna clone
Ordering
For Research Use Only!
Sequence
atggctccagtggagcacgttgtggcggatgctggggctttcctgcggcatgcggctctgcaggacatcgggaagaacatttacaccatccgggaggtggtcactgagattcgggacaaggccacacgcaggcggctcgctgtcctgccctacgagctgcggttcaaggagcccttaccggaatacgtgcggctggtgactgagttttcaaagaaaacaggagactaccccagcctctctgccacggacatccaagtgcttgcactcacataccagttggaagcagagtttgttggggtgtctcacctaaaacaagaaccacagaaggttaaggtgagctcatcgattcagcacccagaaacacctctgcacatttctggtttccatctgccctacaagcctaaacccccacaagaaacagaaaaaggacactcagcttgtgagcctgagaacctggaatttagttccttcatgttctggagaaaccctttgcccaacatcgatcatgaactgcaggagctgctgattgacagaggtgaggacgttccaagtgaggaggaggaggaggaagaaaacgggtttgaagacagaaaagatgacagcgatgacgacgggggtggctggataacccccagtaacatcaagcagatccagcaggagctggagcagtgtgacgtccccgaggacgtgcgggttggctgcctgaccacagacttcgccatgcagaatgttctgctgcagatggggctgcacgtgctggcggtgaacggcatgctgattcgtgaggcccggagctacatcttgcgctgccatggctgtttcaagacaacgtctgacatgagccgagtgttctgctcacactgtgggaacaagaccctgaagaaagtgtccgtgaccgtcagcgacgacggcaccctgcacatgcacttctcccgcaaccccaaggtgctgaacccccgcggcctccggtactcgcttcccactcccaaagggggcaaatacgccatcaacccccatctcaccgaggatcagcgcttccctcagctgcgactctcccaaaaggccaggcagaaaaccaacgtgttcgcccctgactacatcgccggggtgtcaccctttgtcgagaatgacatctccagccgctcagctaccctgcaggtccgggacagcaccttgggagctgggcggagacgcttaaatcccaacgcttccagaaagaagtttgtgaagaaaaggtga
Sequence Length
1239
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
46,675 Da
NCBI Official Full Name
Homo sapiens NIN1/RPN12 binding protein 1 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
NIN1/PSMD8 binding protein 1 homolog
NCBI Official Symbol
NOB1
NCBI Official Synonym Symbols
ART-4; NOB1P; MST158; MSTP158; PSMD8BP1
NCBI Protein Information
RNA-binding protein NOB1
UniProt Protein Name
RNA-binding protein NOB1
Protein Family
UniProt Gene Name
NOB1
UniProt Synonym Gene Names
ART4; NOB1P; PSMD8BP1
UniProt Entry Name
NOB1_HUMAN

NCBI Description

In yeast, over 200 protein and RNA cofactors are required for ribosome assembly, and these are generally conserved in eukaryotes. These factors orchestrate modification and cleavage of the initial 35S precursor rRNA transcript into the mature 18S, 5.8S, and 25S rRNAs, folding of the rRNA, and binding of ribosomal proteins and 5S RNA. Nob1 is involved in pre-rRNA processing. In a late cytoplasmic processing step, Nob1 cleaves a 20S rRNA intermediate at cleavage site D to produce the mature 18S rRNA (Lamanna and Karbstein, 2009 [PubMed 19706509]).[supplied by OMIM, Nov 2010]

Uniprot Description

NOB1P: May play a role in mRNA degradation. Belongs to the NOB1 family.

Protein type: RNA processing

Chromosomal Location of Human Ortholog: 16q22.3

Cellular Component: cytosol; nucleolar preribosome, small subunit precursor; nucleoplasm

Molecular Function: endoribonuclease activity

Biological Process: cleavages during rRNA processing; maturation of SSU-rRNA; rRNA processing

Research Articles on NOB1

Similar Products

Product Notes

The NOB1 nob1 (Catalog #AAA1268140) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctccag tggagcacgt tgtggcggat gctggggctt tcctgcggca tgcggctctg caggacatcg ggaagaacat ttacaccatc cgggaggtgg tcactgagat tcgggacaag gccacacgca ggcggctcgc tgtcctgccc tacgagctgc ggttcaagga gcccttaccg gaatacgtgc ggctggtgac tgagttttca aagaaaacag gagactaccc cagcctctct gccacggaca tccaagtgct tgcactcaca taccagttgg aagcagagtt tgttggggtg tctcacctaa aacaagaacc acagaaggtt aaggtgagct catcgattca gcacccagaa acacctctgc acatttctgg tttccatctg ccctacaagc ctaaaccccc acaagaaaca gaaaaaggac actcagcttg tgagcctgag aacctggaat ttagttcctt catgttctgg agaaaccctt tgcccaacat cgatcatgaa ctgcaggagc tgctgattga cagaggtgag gacgttccaa gtgaggagga ggaggaggaa gaaaacgggt ttgaagacag aaaagatgac agcgatgacg acgggggtgg ctggataacc cccagtaaca tcaagcagat ccagcaggag ctggagcagt gtgacgtccc cgaggacgtg cgggttggct gcctgaccac agacttcgcc atgcagaatg ttctgctgca gatggggctg cacgtgctgg cggtgaacgg catgctgatt cgtgaggccc ggagctacat cttgcgctgc catggctgtt tcaagacaac gtctgacatg agccgagtgt tctgctcaca ctgtgggaac aagaccctga agaaagtgtc cgtgaccgtc agcgacgacg gcaccctgca catgcacttc tcccgcaacc ccaaggtgct gaacccccgc ggcctccggt actcgcttcc cactcccaaa gggggcaaat acgccatcaa cccccatctc accgaggatc agcgcttccc tcagctgcga ctctcccaaa aggccaggca gaaaaccaac gtgttcgccc ctgactacat cgccggggtg tcaccctttg tcgagaatga catctccagc cgctcagcta ccctgcaggt ccgggacagc accttgggag ctgggcggag acgcttaaat cccaacgctt ccagaaagaa gtttgtgaag aaaaggtga. It is sometimes possible for the material contained within the vial of "NOB1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.