ZFP82 cdna clone
ZFP82 cDNA Clone
Gene Names
ZFP82; ZNF545
Synonyms
ZFP82; ZFP82 cDNA Clone; ZFP82 cdna clone
Sequence
atggcccttcgatcagtgatgttcagtgatgtatccatagacttctctccagaagagtgggaatacctggacttggaacaaaaggacttgtacagagatgtcatgttggagaactacagcaacttggtctcactgggatgcttcatttctaaaccagatgtgatttcctcattggagcaaggaaaagagccttggaaagttgtgaggaaaggaagaagacaatatccagatttggagaccaagtatgagaccaagaagttatctttagaaaatgacatttatgaaataaatttatcccagtggaagataatggaaagaattgaaaaccatggccttaagggtctcattttaaaaaatgattgggaatccacaggaaaaattgaaggacaggagagacctcaagaaggatacttcagtagtgtgaaaatgccatctgaaaaggtgtcctcttaccagaaacgcacatctgttactccacatcagagacttcattttgttgataaaccctatgaatgtaaggaatgtgggaaggcgttcagagtgcgccaacagcttacttttcatcacagaattcatactggtgaaaaaccgtatgaatgtaaggaatgtgggatggccttcagacagactgcacaccttactcgacatcagagacttcattctggtgaaaaactctatgaatgtaaggaatgtggggaagctttcatatgtggtgcagatcttagagtacatcagaaaatgcatattggtgagaagccctatgaatgtaaagaatgtgggaaggcttttagggtacgaggacaacttactctgcatcagaggattcatactggtgagaaaccctatgtgtgtaaagagtgtggaaaagcctttagacagtacgcacacctgactcggcatcagaagcttaatagtgctgacaggctctatgaatgcaaagaatgtgggaaggcctttttgtgtggctctggtcttagagtacatcacaaacttcatactggtgagaaaccctatgaatgtaaggaatgcgggaaggcctttagagtgcgacaacaactaacactccatcagagaattcatactggtgagaaaccctatgaatgtaaggaatgtggaaagacctttagccgtggctatcatcttattctccatcacagaattcatactggtgaaaaaccttacgaatgtaaggaatgctggaaagcctttagtcgctactcacaacttatttcacatcagagtattcatattggtgttaagccctatgactgtaaggaatgcgggaaggccttcagactactttcacaactcacacagcatcagagtattcatattggtgagaaaccttataaatgtaaggaatgtggcaaggcctttagattgcgccaaaaacttactctacatcagagcattcatactggcgaaaaaccctttgagtgtaaggaatgtaggaaggcctttagacttaattcatcccttattcaacatctgagaattcattctggtgagaaaccctatgaatgtaaggaatgtaagaaggcctttaggcaacattcacaccttactcatcatctgaaaattcataatgtaaaaatctaa
Sequence Length
1599
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
62,578 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 82 homolog (mouse), mRNA
NCBI Official Synonym Full Names
ZFP82 zinc finger protein
NCBI Official Symbol
ZFP82
NCBI Official Synonym Symbols
ZNF545
NCBI Protein Information
zinc finger protein 82 homolog
UniProt Protein Name
Zinc finger protein 82 homolog
Protein Family
UniProt Gene Name
ZFP82
UniProt Synonym Gene Names
KIAA1948; ZNF545; Zfp-82
UniProt Entry Name
ZFP82_HUMAN
Uniprot Description
ZFP82: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family.
Protein type: Transcription regulation; DNA-binding; C2H2-type zinc finger protein
Chromosomal Location of Human Ortholog: 19q13.12
Molecular Function: transcription factor activity
Biological Process: regulation of transcription, DNA-dependent
Research Articles on ZFP82
Similar Products
Product Notes
The ZFP82 zfp82 (Catalog #AAA1267694) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccttc gatcagtgat gttcagtgat gtatccatag acttctctcc agaagagtgg gaatacctgg acttggaaca aaaggacttg tacagagatg tcatgttgga gaactacagc aacttggtct cactgggatg cttcatttct aaaccagatg tgatttcctc attggagcaa ggaaaagagc cttggaaagt tgtgaggaaa ggaagaagac aatatccaga tttggagacc aagtatgaga ccaagaagtt atctttagaa aatgacattt atgaaataaa tttatcccag tggaagataa tggaaagaat tgaaaaccat ggccttaagg gtctcatttt aaaaaatgat tgggaatcca caggaaaaat tgaaggacag gagagacctc aagaaggata cttcagtagt gtgaaaatgc catctgaaaa ggtgtcctct taccagaaac gcacatctgt tactccacat cagagacttc attttgttga taaaccctat gaatgtaagg aatgtgggaa ggcgttcaga gtgcgccaac agcttacttt tcatcacaga attcatactg gtgaaaaacc gtatgaatgt aaggaatgtg ggatggcctt cagacagact gcacacctta ctcgacatca gagacttcat tctggtgaaa aactctatga atgtaaggaa tgtggggaag ctttcatatg tggtgcagat cttagagtac atcagaaaat gcatattggt gagaagccct atgaatgtaa agaatgtggg aaggctttta gggtacgagg acaacttact ctgcatcaga ggattcatac tggtgagaaa ccctatgtgt gtaaagagtg tggaaaagcc tttagacagt acgcacacct gactcggcat cagaagctta atagtgctga caggctctat gaatgcaaag aatgtgggaa ggcctttttg tgtggctctg gtcttagagt acatcacaaa cttcatactg gtgagaaacc ctatgaatgt aaggaatgcg ggaaggcctt tagagtgcga caacaactaa cactccatca gagaattcat actggtgaga aaccctatga atgtaaggaa tgtggaaaga cctttagccg tggctatcat cttattctcc atcacagaat tcatactggt gaaaaacctt acgaatgtaa ggaatgctgg aaagccttta gtcgctactc acaacttatt tcacatcaga gtattcatat tggtgttaag ccctatgact gtaaggaatg cgggaaggcc ttcagactac tttcacaact cacacagcat cagagtattc atattggtga gaaaccttat aaatgtaagg aatgtggcaa ggcctttaga ttgcgccaaa aacttactct acatcagagc attcatactg gcgaaaaacc ctttgagtgt aaggaatgta ggaaggcctt tagacttaat tcatccctta ttcaacatct gagaattcat tctggtgaga aaccctatga atgtaaggaa tgtaagaagg cctttaggca acattcacac cttactcatc atctgaaaat tcataatgta aaaatctaa. It is sometimes possible for the material contained within the vial of "ZFP82, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
