Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

VPS45 cdna clone

VPS45 cDNA Clone

Gene Names
VPS45; H1; SCN5; VSP45; VPS45A; VPS45B; VPS54A; VSP45A; H1VPS45
Synonyms
VPS45; VPS45 cDNA Clone; VPS45 cdna clone
Ordering
For Research Use Only!
Sequence
atgaacgtggtttttgctgtgaagcagtacatttccaaaatgatagaggacagcgggcctggtatgaaagtacttctcatggataaagagacgactggcatagtgagtatggtatacacacaatcggagattctacagaaggaagtgtacctctttgaacgcattgattctcaaaatcgagagatcatgaaacacctgaaggcaatttgttttcttcgacctacaaaggagaatgtggattatattattcaggagctccgaagacccaaatacactatatatttcatttatttcagtaatgtgatcagcaagagtgacgtgaagtcattggctgaagctgatgaacaggaagttgtggctgaggttcaggaattttatggtgattacattgctgtgaacccacatttgttttccctcaatattttgggttgctgccagggtcgaaattgggatccagcccagctatctagaacaactcaagggcttacagctctccttttatctctgaagaagtgtcccatgattcgttatcagctctcatcagaggcagcaaagagacttgcagagtgcgttaagcaagtgataactaaagaatatgaactgtttgaattccgtcggacagaggttcctccattgctccttattttagatcgctgtgatgatgccatcaccccattgctaaaccagtggacatatcaggccatggtccacgaactactaggcataaacaacaatcggattgatctttccagagtgccgggaatcagtaaagacttaagagaagtggtcctatctgctgaaaatgatgaattctatgctaataatatgtacctgaactttgctgagattggtagcaatataaagaatctcatggaagattttcagaagaagaaaccaaaagaacagcaaaaactagaatcaatagcagacatgaaggcgtttgttgagaattatccacagttcaagaaaatgtctgggactgtttcaaagcatgtgacagtggttggagaactgtctcgattggtcagtgaacggaatctgctggaggtttcagaggttgagcaagaactggcctgtcaaaatgaccattctagtgctctccagaatataaaaaggcttctgcagaaccccaaagtgacagagtttgatgctgcccgcctggtgatgctttatgctttacattatgagcgacacagcagcaatagcctgccaggactaatgatggacctcaggaataaaggtgtttctgagaagtatcgaaagctcgtgtctgcagttgttgaatatggtggtaaacgagtcagaggaagtgacctcttcagccccaaagatgctgtggctatcaccaaacaattcctcaaaggactgaagggagtagaaaatgtatatacacagcatcaacctttcctacatgaaaccctggatcatctcatcaaaggaaggcttaaggaaaacctatatccttatttaggccccagcacactcagagacagacctcaggatatcattgtgtttgtaattggaggagccacctatgaagaggctctaacagtttataacctgaaccgcaccactcctggagtgaggattgtcctgggaggcaccacagtgcacaacacgaaaagtttcctagaggaagttctggcttctggactgcacagccgaagcaaggagagctctcaagtcacatcaaggtcagcgagcagaagatga
Sequence Length
1713
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
61,983 Da
NCBI Official Full Name
Homo sapiens vacuolar protein sorting 45 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
vacuolar protein sorting 45 homolog
NCBI Official Symbol
VPS45
NCBI Official Synonym Symbols
H1; SCN5; VSP45; VPS45A; VPS45B; VPS54A; VSP45A; H1VPS45
NCBI Protein Information
vacuolar protein sorting-associated protein 45
UniProt Protein Name
Vacuolar protein sorting-associated protein 45
UniProt Gene Name
VPS45
UniProt Synonym Gene Names
VPS45A; VPS45B; h-VPS45; hlVps45
UniProt Entry Name
VPS45_HUMAN

NCBI Description

Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene is a member of the Sec1 domain family, and shows a high degree of sequence similarity to mouse, rat and yeast Vps45. The exact function of this gene is not known, but its high expression in peripheral blood mononuclear cells suggests a role in trafficking proteins, including inflammatory mediators. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2013]

Uniprot Description

VPS45A: May play a role in vesicle-mediated protein trafficking from the Golgi stack through the trans-Golgi network. Belongs to the STXBP/unc-18/SEC1 family.

Protein type: Vesicle

Chromosomal Location of Human Ortholog: 1q21.2

Cellular Component: endosome membrane; Golgi apparatus; Golgi membrane; integral to membrane

Molecular Function: protein binding

Biological Process: blood coagulation

Disease: Neutropenia, Severe Congenital, 5, Autosomal Recessive

Research Articles on VPS45

Similar Products

Product Notes

The VPS45 vps45 (Catalog #AAA1267238) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacgtgg tttttgctgt gaagcagtac atttccaaaa tgatagagga cagcgggcct ggtatgaaag tacttctcat ggataaagag acgactggca tagtgagtat ggtatacaca caatcggaga ttctacagaa ggaagtgtac ctctttgaac gcattgattc tcaaaatcga gagatcatga aacacctgaa ggcaatttgt tttcttcgac ctacaaagga gaatgtggat tatattattc aggagctccg aagacccaaa tacactatat atttcattta tttcagtaat gtgatcagca agagtgacgt gaagtcattg gctgaagctg atgaacagga agttgtggct gaggttcagg aattttatgg tgattacatt gctgtgaacc cacatttgtt ttccctcaat attttgggtt gctgccaggg tcgaaattgg gatccagccc agctatctag aacaactcaa gggcttacag ctctcctttt atctctgaag aagtgtccca tgattcgtta tcagctctca tcagaggcag caaagagact tgcagagtgc gttaagcaag tgataactaa agaatatgaa ctgtttgaat tccgtcggac agaggttcct ccattgctcc ttattttaga tcgctgtgat gatgccatca ccccattgct aaaccagtgg acatatcagg ccatggtcca cgaactacta ggcataaaca acaatcggat tgatctttcc agagtgccgg gaatcagtaa agacttaaga gaagtggtcc tatctgctga aaatgatgaa ttctatgcta ataatatgta cctgaacttt gctgagattg gtagcaatat aaagaatctc atggaagatt ttcagaagaa gaaaccaaaa gaacagcaaa aactagaatc aatagcagac atgaaggcgt ttgttgagaa ttatccacag ttcaagaaaa tgtctgggac tgtttcaaag catgtgacag tggttggaga actgtctcga ttggtcagtg aacggaatct gctggaggtt tcagaggttg agcaagaact ggcctgtcaa aatgaccatt ctagtgctct ccagaatata aaaaggcttc tgcagaaccc caaagtgaca gagtttgatg ctgcccgcct ggtgatgctt tatgctttac attatgagcg acacagcagc aatagcctgc caggactaat gatggacctc aggaataaag gtgtttctga gaagtatcga aagctcgtgt ctgcagttgt tgaatatggt ggtaaacgag tcagaggaag tgacctcttc agccccaaag atgctgtggc tatcaccaaa caattcctca aaggactgaa gggagtagaa aatgtatata cacagcatca acctttccta catgaaaccc tggatcatct catcaaagga aggcttaagg aaaacctata tccttattta ggccccagca cactcagaga cagacctcag gatatcattg tgtttgtaat tggaggagcc acctatgaag aggctctaac agtttataac ctgaaccgca ccactcctgg agtgaggatt gtcctgggag gcaccacagt gcacaacacg aaaagtttcc tagaggaagt tctggcttct ggactgcaca gccgaagcaa ggagagctct caagtcacat caaggtcagc gagcagaaga tga. It is sometimes possible for the material contained within the vial of "VPS45, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.