ZBTB6 cdna clone
ZBTB6 cDNA Clone
Gene Names
ZBTB6; ZID; ZNF482
Synonyms
ZBTB6; ZBTB6 cDNA Clone; ZBTB6 cdna clone
Sequence
atggctgctgagtctgatgttctgcatttccagtttgaacagcaaggagatgtggtcttgcagaaaatgaatcttttgagacagcagaatttattttgtgatgtatcaatttacattaatgacactgagttccaggggcacaaggtgattttggctgcttgctccacttttatgagagatcagtttttactcacacagtcaaaacatgtcagaatcaccatcttacagagtgcagaagttggcagaaaattgttactgtcttgctatactggagcacttgaagttaaaaggaaagagcttttgaaatacttgactgctgccagttaccttcagatggttcacattgtggaaaagtgcacagaagctttgtcaaagtatctggaaattgatctttctatgaaaaacaacaaccaacacactgacctgtgtcagtcttctgatcctgatgttaagaatgaagatgaaaattctgataaagactgtgagataattgaaatttcagaagatagtcctgtaaacatagatttccatgttaaagaagaggaaagcaatgctttgcagtctacagtagagagtctgacatcagagagaaaggaaatgaagtcaccagagctgtctacagtagacataggttttaaagacaatgaaatttgtatccttcatgtagaatccatcagtacagctggtgtcgaaaatgggcagttttcacagccttgtacctcttcaaaagcaagcatgtatttctctgaaacacagcattcattgatcaattctacagttgagagcagagtggctgaagttcctgggaatcaagatcagggcttattttgtgagaatactgaaggaagttatggtacagtgagtgagattcagaatctggaggaaggttattcactgaggcaccagtgccccaggtgtcctcgaggctttcttcatgttgaaaactatctgcgccaccttaaaatgcataaactattcttatgcttacagtgcggaaaaacatttacacagaagaaaaatctcaaccgacacatccgaggacacatgggcatacggccctttcagtgtactgtgtgcttgaagacatttactgccaaaagcacacttcaggaccacttgaacatacacagtggggatcggccatacaaatgccactgttgtgatatggatttcaagcacaagtctgctctcaaaaagcacttaacctctgtccatggcagaagcagtggtgaaaaactatctaggcctgatctcaaaaggcaaagtctactataa
Sequence Length
1275
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
48,236 Da
NCBI Official Full Name
Homo sapiens zinc finger and BTB domain containing 6, mRNA
NCBI Official Synonym Full Names
zinc finger and BTB domain containing 6
NCBI Official Symbol
ZBTB6
NCBI Official Synonym Symbols
ZID; ZNF482
NCBI Protein Information
zinc finger and BTB domain-containing protein 6
UniProt Protein Name
Zinc finger and BTB domain-containing protein 6
Protein Family
UniProt Gene Name
ZBTB6
UniProt Synonym Gene Names
ZID; ZNF482
UniProt Entry Name
ZBTB6_HUMAN
Uniprot Description
ZBTB6: May be involved in transcriptional regulation.
Protein type: C2H2-type zinc finger protein
Chromosomal Location of Human Ortholog: 9q33.2
Molecular Function: protein binding
Similar Products
Product Notes
The ZBTB6 zbtb6 (Catalog #AAA1266754) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgctg agtctgatgt tctgcatttc cagtttgaac agcaaggaga tgtggtcttg cagaaaatga atcttttgag acagcagaat ttattttgtg atgtatcaat ttacattaat gacactgagt tccaggggca caaggtgatt ttggctgctt gctccacttt tatgagagat cagtttttac tcacacagtc aaaacatgtc agaatcacca tcttacagag tgcagaagtt ggcagaaaat tgttactgtc ttgctatact ggagcacttg aagttaaaag gaaagagctt ttgaaatact tgactgctgc cagttacctt cagatggttc acattgtgga aaagtgcaca gaagctttgt caaagtatct ggaaattgat ctttctatga aaaacaacaa ccaacacact gacctgtgtc agtcttctga tcctgatgtt aagaatgaag atgaaaattc tgataaagac tgtgagataa ttgaaatttc agaagatagt cctgtaaaca tagatttcca tgttaaagaa gaggaaagca atgctttgca gtctacagta gagagtctga catcagagag aaaggaaatg aagtcaccag agctgtctac agtagacata ggttttaaag acaatgaaat ttgtatcctt catgtagaat ccatcagtac agctggtgtc gaaaatgggc agttttcaca gccttgtacc tcttcaaaag caagcatgta tttctctgaa acacagcatt cattgatcaa ttctacagtt gagagcagag tggctgaagt tcctgggaat caagatcagg gcttattttg tgagaatact gaaggaagtt atggtacagt gagtgagatt cagaatctgg aggaaggtta ttcactgagg caccagtgcc ccaggtgtcc tcgaggcttt cttcatgttg aaaactatct gcgccacctt aaaatgcata aactattctt atgcttacag tgcggaaaaa catttacaca gaagaaaaat ctcaaccgac acatccgagg acacatgggc atacggccct ttcagtgtac tgtgtgcttg aagacattta ctgccaaaag cacacttcag gaccacttga acatacacag tggggatcgg ccatacaaat gccactgttg tgatatggat ttcaagcaca agtctgctct caaaaagcac ttaacctctg tccatggcag aagcagtggt gaaaaactat ctaggcctga tctcaaaagg caaagtctac tataa. It is sometimes possible for the material contained within the vial of "ZBTB6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
