PRKRIR cdna clone
PRKRIR cDNA Clone
Gene Names
THAP12; DAP4; THAP0; PRKRIR; P52rIPK
Synonyms
PRKRIR; PRKRIR cDNA Clone; PRKRIR cdna clone
Sequence
atgccgaacttctgcgctgcccccaactgcacgcggaagagcacgcagtccgacttggccttcttcaggttcccgcgggaccctgccagatgccagaagtgggtggagaactgtaggagagcagacttagaagataaaacacctgatcagctaaataaacattatcgattatgtgccaaacattttgagacctctatgatctgtagaactagtccttataggacagttcttcgagataatgcaataccaacaatatttgatcttaccagtcatttgaacaacccacatagtagacacagaaaacgaataaaagaactgagtgaagatgaaatcaggacactgaaacagaaaaaaattgatgaaacttctgagcaggaacaaaaacataaagaaaccaacaatagcaatgctcagaaccccagcgaagaagagggtgaagggcaagatgaggacattttacctctaacccttgaagagaaggaaaacaaagaatacctaaaatctctatttgaaatcttgattctgatgggaaagcaaaacatacctctggatggacatgaggctgatgaaatcccagaaggtctctttactccagataactttcaggcactgctggagtgtcggataaattctggtgaagaggttctgagaaagcggtttgagacaacagcagttaacacgttgttttgttcaaaaacacagcagaggcagatgctagagatctgtgagagctgtattcgagaagaaactctcagggaagtgagagactcacacttcttttccattatcactgacgatgtagtggacatagcaggggaagagcacctacctgtgttggtgaggtttgttgatgaatctcataacctaagagaggaatttataggcttcctgccttatgaagccgatgcagaaattttggctgtgaaatttcacactatgataactgagaagtggggattaaatatggagtattgtcgtggccaggcttacattgtctctagtggattttcttccaaaatgaaagttgttgcttctagacttttagagaaatatccccaagctatctacacactctgctcttcctgtgccttaaatatgtggttggcaaaatcagtacctgttatgggagtatctgttgcattaggaacaattgaggaagtttgttcttttttccatcgatcaccacaactgcttttagaacttgacaacgtaatttctgttctttttcagaacagtaaagaaaggggtaaagaactgaaggaaatctgccattctcagtggacaggcaggcatgatgcttttgaaattttagtggaactcctgcaagcacttgttttatgtttagatggtataaatagtgacacaaatattagatggaataactatatagctggccgagcatttgtactctgcagtgcagtgtcagattttgatttcattgttactattgttgttcttaaaaatgtcctatcttttacaagagcctttgggaaaaacctccaggggcaaacctctgatgtcttctttgcggccggtagcttgactgcagtactgcattcactcaacgaagtgatggaaaatattgaagtttatcatgaattttggtttgaggaagccacaaatttggcaaccaaacttgatattcaaatgaaactccctgggaaattccgcagagctcaccagggtaacttggaatctcagctaacctctgagagttactataaagaaaccctaagtgtcccaacagtggagcacattattcaggaacttaaagatatattctcagaacagcacctcaaagctcttaaatgcttatctctggtaccctcagtcatgggacaactcaaattcaatacgtcggaggaacaccatgctgacatgtatagaagtgacttacccaatcctgacacgctgtcagctgagcttcattgttggagaatcaaatggaaacacagggggaaagatatagagcttccgtccaccatctatgaagccctccacctgcctgacatcaagttttttcctaatgtgtatgcattgctgaaggtcctgtgtattcttcctgtgatgaaggttgagaatgagcggtatgaaaatggacgaaagcgtcttaaagcatatttgaggaacactttgacagaccaaaggtcaagtaacttggctttgcttaacataaattttgatataaaacacgacctggatttaatggtggacacatatattaaactctatacaagtaagtcagagcttcctacagataattccgaaactgtggaaaatacctaa
Sequence Length
2286
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
56,656 Da
NCBI Official Full Name
Homo sapiens protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor), mRNA
NCBI Official Synonym Full Names
THAP domain containing 12
NCBI Official Symbol
THAP12
NCBI Official Synonym Symbols
DAP4; THAP0; PRKRIR; P52rIPK
NCBI Protein Information
52 kDa repressor of the inhibitor of the protein kinase
UniProt Protein Name
52 kDa repressor of the inhibitor of the protein kinase
UniProt Gene Name
THAP12
UniProt Synonym Gene Names
p52rIPK; p58IPK-interacting protein
UniProt Entry Name
P52K_HUMAN
Uniprot Description
PRKRIR: Upstream regulator of interferon-induced serine/threonine protein kinase R (PKR). May block the PKR- inhibitory function of P58IPK, resulting in restoration of kinase activity and suppression of cell growth. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Cell cycle regulation; Protein kinase, regulatory subunit
Chromosomal Location of Human Ortholog: 11q13.5
Cellular Component: cytoplasm; nucleoplasm
Molecular Function: DNA binding; protein binding
Biological Process: negative regulation of cell proliferation; response to stress; signal transduction
Research Articles on PRKRIR
Similar Products
Product Notes
The PRKRIR thap12 (Catalog #AAA1266532) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgaact tctgcgctgc ccccaactgc acgcggaaga gcacgcagtc cgacttggcc ttcttcaggt tcccgcggga ccctgccaga tgccagaagt gggtggagaa ctgtaggaga gcagacttag aagataaaac acctgatcag ctaaataaac attatcgatt atgtgccaaa cattttgaga cctctatgat ctgtagaact agtccttata ggacagttct tcgagataat gcaataccaa caatatttga tcttaccagt catttgaaca acccacatag tagacacaga aaacgaataa aagaactgag tgaagatgaa atcaggacac tgaaacagaa aaaaattgat gaaacttctg agcaggaaca aaaacataaa gaaaccaaca atagcaatgc tcagaacccc agcgaagaag agggtgaagg gcaagatgag gacattttac ctctaaccct tgaagagaag gaaaacaaag aatacctaaa atctctattt gaaatcttga ttctgatggg aaagcaaaac atacctctgg atggacatga ggctgatgaa atcccagaag gtctctttac tccagataac tttcaggcac tgctggagtg tcggataaat tctggtgaag aggttctgag aaagcggttt gagacaacag cagttaacac gttgttttgt tcaaaaacac agcagaggca gatgctagag atctgtgaga gctgtattcg agaagaaact ctcagggaag tgagagactc acacttcttt tccattatca ctgacgatgt agtggacata gcaggggaag agcacctacc tgtgttggtg aggtttgttg atgaatctca taacctaaga gaggaattta taggcttcct gccttatgaa gccgatgcag aaattttggc tgtgaaattt cacactatga taactgagaa gtggggatta aatatggagt attgtcgtgg ccaggcttac attgtctcta gtggattttc ttccaaaatg aaagttgttg cttctagact tttagagaaa tatccccaag ctatctacac actctgctct tcctgtgcct taaatatgtg gttggcaaaa tcagtacctg ttatgggagt atctgttgca ttaggaacaa ttgaggaagt ttgttctttt ttccatcgat caccacaact gcttttagaa cttgacaacg taatttctgt tctttttcag aacagtaaag aaaggggtaa agaactgaag gaaatctgcc attctcagtg gacaggcagg catgatgctt ttgaaatttt agtggaactc ctgcaagcac ttgttttatg tttagatggt ataaatagtg acacaaatat tagatggaat aactatatag ctggccgagc atttgtactc tgcagtgcag tgtcagattt tgatttcatt gttactattg ttgttcttaa aaatgtccta tcttttacaa gagcctttgg gaaaaacctc caggggcaaa cctctgatgt cttctttgcg gccggtagct tgactgcagt actgcattca ctcaacgaag tgatggaaaa tattgaagtt tatcatgaat tttggtttga ggaagccaca aatttggcaa ccaaacttga tattcaaatg aaactccctg ggaaattccg cagagctcac cagggtaact tggaatctca gctaacctct gagagttact ataaagaaac cctaagtgtc ccaacagtgg agcacattat tcaggaactt aaagatatat tctcagaaca gcacctcaaa gctcttaaat gcttatctct ggtaccctca gtcatgggac aactcaaatt caatacgtcg gaggaacacc atgctgacat gtatagaagt gacttaccca atcctgacac gctgtcagct gagcttcatt gttggagaat caaatggaaa cacaggggga aagatataga gcttccgtcc accatctatg aagccctcca cctgcctgac atcaagtttt ttcctaatgt gtatgcattg ctgaaggtcc tgtgtattct tcctgtgatg aaggttgaga atgagcggta tgaaaatgga cgaaagcgtc ttaaagcata tttgaggaac actttgacag accaaaggtc aagtaacttg gctttgctta acataaattt tgatataaaa cacgacctgg atttaatggt ggacacatat attaaactct atacaagtaa gtcagagctt cctacagata attccgaaac tgtggaaaat acctaa. It is sometimes possible for the material contained within the vial of "PRKRIR, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
