Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ATP6AP1 cdna clone

ATP6AP1 cDNA Clone

Gene Names
ATP6AP1; 16A; CF2; Ac45; XAP3; XAP-3; ATP6S1; VATPS1; ATP6IP1
Synonyms
ATP6AP1; ATP6AP1 cDNA Clone; ATP6AP1 cdna clone
Ordering
For Research Use Only!
Sequence
atgatggcggccatggcgacggctcgagtgcggatggggccgcggtgcgcccaggcgctctggcgcatgccgtggctgccggtgtttttgtcgttggcggcggcggcggcggcggcagcggcggagcagcaggtcccgctggtgctgtggtcgagtgaccgggacttgtgggctcctgcggccgacactcatgaaggccacatcaccagcgacttgcagctctctacctacttagatcccgccctggagctgggtcccaggaatgtgctgctgttcctgcaggacaagctgagcattgaggatttcacagcatatggcggtgtgtttggaaacaagcaggacagcgccttttctaacctagagaatgccctggacctggccccctcctcactggtgcttcctgccgtcgactggtatgcagtcagcactctgaccacttacctgcaggagaagctcggggccagccccttgcatgtggacctggccaccctgcgggagctgaagctcaatgccagcctccctgctctgctgctcattcgcctgccctacacagccagctctggtctgatggcacccagggaagtcctcacaggcaacgatgaggtcatcgggcaggtcctgagcacactcaagtccgaagatgtcccatacacagcggccctcacagcggtccgcccttccagggtggcccgtgatgtagccgtggtggccggagggctaggtcgccagctgctacaaaaacagccagtatcacctgtgatccatcctcctgtgagttacaatgacaccgctccccggatcctgttctgggcccaaaacttctctgtggcgtacaaggaccagtgggaggacctgactcccctcacctttggggtgcaggaactcaacctgactggctccttctggaatgactcctttgccaggctctcactgacctatgaacgactctttggtaccacagtgacattcaagttcattctggccaaccgcctctacccagtgtctgcccggcactggtttaccatggagcgcctcgaagtccacagcaatggctccgtcgcctacttcaatgcttcccaggtcacagggcccagcatctactccttccactgcgagtatgtcagcagcctgagcaagaagggtagtctcctcgtggcccgcacgcagccctctccctggcagatgatgcttcaggacttccagatccaggctttcaacgtaatgggggagcagttctcctacgccagcgactgtgccagcttcttctcccccggcatctggatggggctgctcacctccctgttcatgctcttcatcttcacctatggcctgcacatgatcctcagcctcaagaccatggatcgctttgatgaccacaagggccccactatttctttgacccagattgtgtga
Sequence Length
1413
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
537
Molecular Weight
52,026 Da
NCBI Official Full Name
Homo sapiens ATPase, H+ transporting, lysosomal accessory protein 1, mRNA
NCBI Official Synonym Full Names
ATPase H+ transporting accessory protein 1
NCBI Official Symbol
ATP6AP1
NCBI Official Synonym Symbols
16A; CF2; Ac45; XAP3; XAP-3; ATP6S1; VATPS1; ATP6IP1
NCBI Protein Information
V-type proton ATPase subunit S1
UniProt Protein Name
V-type proton ATPase subunit S1
Protein Family
UniProt Gene Name
ATP6AP1
UniProt Synonym Gene Names
ATP6IP1; ATP6S1; VATPS1; XAP3; V-ATPase subunit S1
UniProt Entry Name
VAS1_HUMAN

NCBI Description

This gene encodes a component of a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. Vacuolar ATPase (V-ATPase) is comprised of a cytosolic V1 (site of the ATP catalytic site) and a transmembrane V0 domain. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, and receptor-mediated endocytosis. The encoded protein of this gene may assist in the V-ATPase-mediated acidification of neuroendocrine secretory granules. This protein may also play a role in early development. [provided by RefSeq, Aug 2013]

Uniprot Description

ATP6AP1: Vacuolar ATPase is responsible for acidifying a variety of intracellular compartments in eukaryotic cells. Belongs to the vacuolar ATPase subunit S1 family.

Protein type: EC 3.6.3.14; Membrane protein, integral; Energy Metabolism - oxidative phosphorylation; Hydrolase; Transporter

Chromosomal Location of Human Ortholog: Xq28

Cellular Component: endosome membrane; proton-transporting two-sector ATPase complex

Molecular Function: Rab GTPase binding; transporter activity

Biological Process: establishment of organelle localization; insulin receptor signaling pathway; pH reduction; positive regulation of bone resorption; positive regulation of exocytosis; positive regulation of osteoblast differentiation; proton transport; transferrin transport

Disease: Immunodeficiency 47

Research Articles on ATP6AP1

Similar Products

Product Notes

The ATP6AP1 atp6ap1 (Catalog #AAA1266172) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatggcgg ccatggcgac ggctcgagtg cggatggggc cgcggtgcgc ccaggcgctc tggcgcatgc cgtggctgcc ggtgtttttg tcgttggcgg cggcggcggc ggcggcagcg gcggagcagc aggtcccgct ggtgctgtgg tcgagtgacc gggacttgtg ggctcctgcg gccgacactc atgaaggcca catcaccagc gacttgcagc tctctaccta cttagatccc gccctggagc tgggtcccag gaatgtgctg ctgttcctgc aggacaagct gagcattgag gatttcacag catatggcgg tgtgtttgga aacaagcagg acagcgcctt ttctaaccta gagaatgccc tggacctggc cccctcctca ctggtgcttc ctgccgtcga ctggtatgca gtcagcactc tgaccactta cctgcaggag aagctcgggg ccagcccctt gcatgtggac ctggccaccc tgcgggagct gaagctcaat gccagcctcc ctgctctgct gctcattcgc ctgccctaca cagccagctc tggtctgatg gcacccaggg aagtcctcac aggcaacgat gaggtcatcg ggcaggtcct gagcacactc aagtccgaag atgtcccata cacagcggcc ctcacagcgg tccgcccttc cagggtggcc cgtgatgtag ccgtggtggc cggagggcta ggtcgccagc tgctacaaaa acagccagta tcacctgtga tccatcctcc tgtgagttac aatgacaccg ctccccggat cctgttctgg gcccaaaact tctctgtggc gtacaaggac cagtgggagg acctgactcc cctcaccttt ggggtgcagg aactcaacct gactggctcc ttctggaatg actcctttgc caggctctca ctgacctatg aacgactctt tggtaccaca gtgacattca agttcattct ggccaaccgc ctctacccag tgtctgcccg gcactggttt accatggagc gcctcgaagt ccacagcaat ggctccgtcg cctacttcaa tgcttcccag gtcacagggc ccagcatcta ctccttccac tgcgagtatg tcagcagcct gagcaagaag ggtagtctcc tcgtggcccg cacgcagccc tctccctggc agatgatgct tcaggacttc cagatccagg ctttcaacgt aatgggggag cagttctcct acgccagcga ctgtgccagc ttcttctccc ccggcatctg gatggggctg ctcacctccc tgttcatgct cttcatcttc acctatggcc tgcacatgat cctcagcctc aagaccatgg atcgctttga tgaccacaag ggccccacta tttctttgac ccagattgtg tga. It is sometimes possible for the material contained within the vial of "ATP6AP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.