SACM1L cdna clone

SACM1L cDNA Clone

Gene Names

SACM1L; SAC1

Synonyms

SACM1L; SACM1L cDNA Clone; SACM1L cdna clone

Ordering
Cat. Num. AAA1266162 For Research Use Only!

Sequence

atggcgacggcggcctacgagcagctgaagctgcatatcacacctgaaaaattttatgtggaagcttgtgatgatggagcagatgacgtacttaccattgaccgtgtgtccacagaggttacccttgcagtcaagaaagatgttcctccttcagctgtcacaagaccaatatttggtatactgggcacaatccatctggtggcaggtaattatcttatagtcattaccaaaaagataaaagtaggtgaatttttcagtcatgtagtctggaaagcaacagattttgatgtcctttcttataagaagacaatgttgcacttaactgatattcagttacaagataataaaaccttcctagcgatgctaaaccatgtcttgaatgtggatggattttacttttcaacaacatatgatttgacccatactttgcagcggctatccaacactagtcctgaattccaagaaatgagtctcttggaaagggcagatcagcggtttgtatggaatggtcatcttctaagagaactttctgcacagccagaggttcatcggtttgcccttccagtgttacatggctttattaccatgcattcatgttctattaatggaaaatactttgattggattctcatctcgaggaggagctgtttcagagctggtgtgcgctattatgtaagaggaattgattcggaaggccatgcagctaactttgtagaaacagaacaaattgtgcactacaatgggagcaaagcttcgtttgtacagactcgaggatcaatacctgttttctggtcccaaagaccaaacctcaagtacaaaccactgccacagatcagcaaagtagcaaatcacatggacggtttccaaaggcattttgattcccaagtaattatttatggaaaacaagttataatcaatctgattaaccagaagggctcggagaagccacttgagcagacatttgcaacaatggtgtcttccttgggaagtggaatgatgagatacattgcctttgacttccataaggaatgtaaaaatatgagatgggatcgactaagtattttattggatcaggtagcagaaatgcaagatgaattaagttattttctagtggactctgctggccaggtggtggcaaaccaggaaggcgtgttccgaagcaattgcatggattgtctagatagaaccaatgtgatccagagtttgttagctcgtcgttcacttcaggcccaacttcagagactaggagttttgcatgtgggacaaaagcttgaagaacaagatgaatttgagaagattttcaaaaatgcctgggctgacaacgcaaatgcttgtgccaagcaatatgcgggaactggtgccttgaagactgactttaccagaactggaaagagaactcatttgggacttataatggatggctggaactcaatgatacgatattataagaacaacttttccgatggatttagacaagattccatagacttatttcttggaaactattcagtggatgaattagaatctcatagtcctttaagtgttccaagggactggaaattcctggctttgcctattatcatggttgttgccttttcaatgtgcattatctgtttgcttatggctggtgacacttggacagaaacactggcctatgtgctcttctggggagttgcaagcattggaacattttttatcattctttacaatggcaaagattttgtcgatgctcccagactggtccagaaagaaaagatagactga

Sequence Length

1764

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

16741487

NCBI GeneID

22908

Molecular Weight

60,853 Da

NCBI Official Full Name

Homo sapiens SAC1 suppressor of actin mutations 1-like (yeast), mRNA

NCBI Official Synonym Full Names

SAC1 suppressor of actin mutations 1-like (yeast)

NCBI Official Symbol

SACM1L

NCBI Official Synonym Symbols

SAC1

NCBI Protein Information

phosphatidylinositide phosphatase SAC1

UniProt Protein Name

Phosphatidylinositide phosphatase SAC1

UniProt Gene Name

SACM1L

UniProt Entry Name

SAC1_HUMAN

NCBI Description

This gene encodes an integral membrane protein that is localized to the endoplasmic reticulum and golgi, and functions as a phosphoinositide lipid phosphatase. Studies in mammals suggest that this gene is involved in the organization of golgi membranes and the mitotic spindles. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2016]

Uniprot Description

SACM1L: Phosphoinositide phosphatase that hydrolyzes PtdIns(3)P and PtdIns(4)P. Has low activity towards PtdIns(3,5)P2.

Protein type: Motility/polarity/chemotaxis; Phosphatase, lipid; Membrane protein, multi-pass; Membrane protein, integral; EC 3.1.3.-

Chromosomal Location of Human Ortholog: 3p21.3

Cellular Component: endoplasmic reticulum membrane; Golgi apparatus; Golgi membrane

Molecular Function: phosphatidylinositol-3-phosphatase activity; phosphatidylinositol-4-phosphate phosphatase activity; phosphoric monoester hydrolase activity; protein binding

Biological Process: phosphatidylinositol biosynthetic process; phosphoinositide dephosphorylation

Research Articles on SACM1L

1. data suggest a model in which the 14-3-3 protein mediates SAC1 traffic from the ER through direct interaction with a sorting signal and COPII

Similar Products

Product Notes

The SACM1L sacm1l (Catalog #AAA1266162) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgacgg cggcctacga gcagctgaag ctgcatatca cacctgaaaa attttatgtg gaagcttgtg atgatggagc agatgacgta cttaccattg accgtgtgtc cacagaggtt acccttgcag tcaagaaaga tgttcctcct tcagctgtca caagaccaat atttggtata ctgggcacaa tccatctggt ggcaggtaat tatcttatag tcattaccaa aaagataaaa gtaggtgaat ttttcagtca tgtagtctgg aaagcaacag attttgatgt cctttcttat aagaagacaa tgttgcactt aactgatatt cagttacaag ataataaaac cttcctagcg atgctaaacc atgtcttgaa tgtggatgga ttttactttt caacaacata tgatttgacc catactttgc agcggctatc caacactagt cctgaattcc aagaaatgag tctcttggaa agggcagatc agcggtttgt atggaatggt catcttctaa gagaactttc tgcacagcca gaggttcatc ggtttgccct tccagtgtta catggcttta ttaccatgca ttcatgttct attaatggaa aatactttga ttggattctc atctcgagga ggagctgttt cagagctggt gtgcgctatt atgtaagagg aattgattcg gaaggccatg cagctaactt tgtagaaaca gaacaaattg tgcactacaa tgggagcaaa gcttcgtttg tacagactcg aggatcaata cctgttttct ggtcccaaag accaaacctc aagtacaaac cactgccaca gatcagcaaa gtagcaaatc acatggacgg tttccaaagg cattttgatt cccaagtaat tatttatgga aaacaagtta taatcaatct gattaaccag aagggctcgg agaagccact tgagcagaca tttgcaacaa tggtgtcttc cttgggaagt ggaatgatga gatacattgc ctttgacttc cataaggaat gtaaaaatat gagatgggat cgactaagta ttttattgga tcaggtagca gaaatgcaag atgaattaag ttattttcta gtggactctg ctggccaggt ggtggcaaac caggaaggcg tgttccgaag caattgcatg gattgtctag atagaaccaa tgtgatccag agtttgttag ctcgtcgttc acttcaggcc caacttcaga gactaggagt tttgcatgtg ggacaaaagc ttgaagaaca agatgaattt gagaagattt tcaaaaatgc ctgggctgac aacgcaaatg cttgtgccaa gcaatatgcg ggaactggtg ccttgaagac tgactttacc agaactggaa agagaactca tttgggactt ataatggatg gctggaactc aatgatacga tattataaga acaacttttc cgatggattt agacaagatt ccatagactt atttcttgga aactattcag tggatgaatt agaatctcat agtcctttaa gtgttccaag ggactggaaa ttcctggctt tgcctattat catggttgtt gccttttcaa tgtgcattat ctgtttgctt atggctggtg acacttggac agaaacactg gcctatgtgc tcttctgggg agttgcaagc attggaacat tttttatcat tctttacaat ggcaaagatt ttgtcgatgc tcccagactg gtccagaaag aaaagataga ctga. It is sometimes possible for the material contained within the vial of "SACM1L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

SACM1L cdna clone