STARD7 cdna clone
STARD7 cDNA Clone
Gene Names
STARD7; GTT1
Synonyms
STARD7; STARD7 cDNA Clone; STARD7 cdna clone
Sequence
atggcggcgttagccggcgtcttcgtttgggacgaggagaggatccaggaggaggagttgcagagatctattaatgagatgaagcggttggaagaaatgtcaaatatgtttcagagctctggagtccagcaccaccctccagaaccaaaagcccaaacagaagggaatgaagattcagagggcaaagagcaacgttgggaaatggtgatggataagaaacactttaagctgtggcggcgcccaattacaggcacccacctttaccagtaccgagtttttggaacctacacagatgtgacacctcggcagttcttcaatgttcagctggacacagagtatagaaaaaaatgggatgccctggtaatcaagctggaggtgattgagagggatgtggttagtggttccgaggttcttcactgggtaacccattttccttatccaatgtactcacgggattatgtttatgttcggcggtatagtgtggatcaggaaaacaacatgatggtgttggtgtcgcgtgctgtggagcatccgagtgtgccagagtctccagaattcgtcagggtcagatcatatgaatcccaaatggttatccgtccccacaagtcatttgatgagaatggctttgactacttactaacatacagtgacaatccccaaacggtgtttcctcgctactgtgttagttggatggtttccagtggcatgccagatttcctggagaagctgcacatggccactctgaaagccaagaatatggagattaaagtaaaggactacatctcagctaagcctctggaaatgagtagtgaagccaaggccaccagccagtcctctgagcgaaagaacgagggcagctgtggccctgctcggattgagtatgcttga
Sequence Length
888
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
43,113 Da
NCBI Official Full Name
Homo sapiens StAR-related lipid transfer (START) domain containing 7, mRNA
NCBI Official Synonym Full Names
StAR related lipid transfer domain containing 7
NCBI Official Symbol
STARD7
NCBI Official Synonym Symbols
GTT1
NCBI Protein Information
stAR-related lipid transfer protein 7, mitochondrial
UniProt Protein Name
StAR-related lipid transfer protein 7, mitochondrial
Protein Family
UniProt Gene Name
STARD7
UniProt Synonym Gene Names
GTT1; StARD7
UniProt Entry Name
STAR7_HUMAN
NCBI Description
Although the function of this gene is not known, its existence is supported by mRNA and EST data. The predicted gene product contains a region similar to the STAR-related lipid transfer (START) domain, which is often present in proteins involved in the cell signaling mediated by lipid binding. Alternatively spliced transcript variants have been described, although some transcripts occur only in cancer cell lines. [provided by RefSeq, Jul 2008]
Uniprot Description
STARD7: May play a protective role in mucosal tissues by preventing exaggerated allergic responses. {ECO:0000250|UniProtKB:Q8R1R3}
Chromosomal Location of Human Ortholog: 2q11.2
Research Articles on STARD7
Similar Products
Product Notes
The STARD7 stard7 (Catalog #AAA1266087) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgt tagccggcgt cttcgtttgg gacgaggaga ggatccagga ggaggagttg cagagatcta ttaatgagat gaagcggttg gaagaaatgt caaatatgtt tcagagctct ggagtccagc accaccctcc agaaccaaaa gcccaaacag aagggaatga agattcagag ggcaaagagc aacgttggga aatggtgatg gataagaaac actttaagct gtggcggcgc ccaattacag gcacccacct ttaccagtac cgagtttttg gaacctacac agatgtgaca cctcggcagt tcttcaatgt tcagctggac acagagtata gaaaaaaatg ggatgccctg gtaatcaagc tggaggtgat tgagagggat gtggttagtg gttccgaggt tcttcactgg gtaacccatt ttccttatcc aatgtactca cgggattatg tttatgttcg gcggtatagt gtggatcagg aaaacaacat gatggtgttg gtgtcgcgtg ctgtggagca tccgagtgtg ccagagtctc cagaattcgt cagggtcaga tcatatgaat cccaaatggt tatccgtccc cacaagtcat ttgatgagaa tggctttgac tacttactaa catacagtga caatccccaa acggtgtttc ctcgctactg tgttagttgg atggtttcca gtggcatgcc agatttcctg gagaagctgc acatggccac tctgaaagcc aagaatatgg agattaaagt aaaggactac atctcagcta agcctctgga aatgagtagt gaagccaagg ccaccagcca gtcctctgag cgaaagaacg agggcagctg tggccctgct cggattgagt atgcttga. It is sometimes possible for the material contained within the vial of "STARD7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
