Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZC3H8 cdna clone

ZC3H8 cDNA Clone

Gene Names
ZC3H8; Fliz1; ZC3HDC8
Synonyms
ZC3H8; ZC3H8 cDNA Clone; ZC3H8 cdna clone
Ordering
For Research Use Only!
Sequence
atggattttgagaatcttttctcaaaaccccccaacccggccctcggcaaaacggccacggactctgacgaaagaatcgatgatgaaatagatacagaagttgaagaaacacaagaagagaaaattaaactggagtgcgagcaaattcccaaaaaatttagacactctgcaatatcaccaaaaagttcgctgcatagaaaatcaagaagtaaggactatgatgtatatagtgataatgatatctgcagtcaggaatcagaagataattttgccaaagagcttcaacagtacatacaagccagagaaatggcaaatgctgctcaacctgaagaatctacaaagaaagaaggagtaaaagataccccacaggctgctaaacaaaaaaataaaaatcttaaagctggtcacaagaatggcaaacagaagaaaatgaagcgaaaatggcctggccctggaaacaaaggatcaaatgctttgctgaggaacagcggctcacaggaagaggacggtaaacctaaagagaagcagcagcatttgagtcaggcattcatcaaccaacatacagtggaacgcaagggaaaacaaatttgtaaatattttcttgaaaggaaatgtattaagggagaccagtgtaaatttgatcatgatgcagagatagaaaagaaaaaggaaatgtgtaagttttatgtacaaggatattgtaccagaggtgaaaactgtctgtatttgcataatgaatatccttgtaagttttaccatacaggaacaaaatgttatcagggagaatactgcaagttttctcatgctccactgactcctgaaacacaagaattgttggctaaagttttggatactgaaaagaagtcatgtaataaaatagacataaaaaggtag
Sequence Length
894
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
33,576 Da
NCBI Official Full Name
Homo sapiens zinc finger CCCH-type containing 8, mRNA
NCBI Official Synonym Full Names
zinc finger CCCH-type containing 8
NCBI Official Symbol
ZC3H8
NCBI Official Synonym Symbols
Fliz1; ZC3HDC8
NCBI Protein Information
zinc finger CCCH domain-containing protein 8
UniProt Protein Name
Zinc finger CCCH domain-containing protein 8
UniProt Gene Name
ZC3H8
UniProt Synonym Gene Names
ZC3HDC8
UniProt Entry Name
ZC3H8_HUMAN

Uniprot Description

ZC3H8: Acts as a transcriptional repressor of the GATA3 promoter. Sequence-specific DNA-binding factor that binds to the 5'-AGGTCTC-3' sequence within the negative cis-acting element intronic regulatory region (IRR) of the GATA3 gene. Induces thymocyte apoptosis when overexpressed, which may indicate a role in regulation of thymocyte homeostasis.

Protein type: DNA-binding

Chromosomal Location of Human Ortholog: 2q13

Cellular Component: Cajal body; nucleoplasm; nucleus; transcription elongation factor complex

Molecular Function: protein binding; sequence-specific DNA binding; transcription factor activity

Biological Process: negative regulation of T cell differentiation in the thymus; negative regulation of transcription, DNA-dependent; positive regulation of transcription from RNA polymerase III promoter; response to antibiotic; snRNA transcription from RNA polymerase II promoter; snRNA transcription from RNA polymerase III promoter; T cell homeostasis

Similar Products

Product Notes

The ZC3H8 zc3h8 (Catalog #AAA1265658) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggattttg agaatctttt ctcaaaaccc cccaacccgg ccctcggcaa aacggccacg gactctgacg aaagaatcga tgatgaaata gatacagaag ttgaagaaac acaagaagag aaaattaaac tggagtgcga gcaaattccc aaaaaattta gacactctgc aatatcacca aaaagttcgc tgcatagaaa atcaagaagt aaggactatg atgtatatag tgataatgat atctgcagtc aggaatcaga agataatttt gccaaagagc ttcaacagta catacaagcc agagaaatgg caaatgctgc tcaacctgaa gaatctacaa agaaagaagg agtaaaagat accccacagg ctgctaaaca aaaaaataaa aatcttaaag ctggtcacaa gaatggcaaa cagaagaaaa tgaagcgaaa atggcctggc cctggaaaca aaggatcaaa tgctttgctg aggaacagcg gctcacagga agaggacggt aaacctaaag agaagcagca gcatttgagt caggcattca tcaaccaaca tacagtggaa cgcaagggaa aacaaatttg taaatatttt cttgaaagga aatgtattaa gggagaccag tgtaaatttg atcatgatgc agagatagaa aagaaaaagg aaatgtgtaa gttttatgta caaggatatt gtaccagagg tgaaaactgt ctgtatttgc ataatgaata tccttgtaag ttttaccata caggaacaaa atgttatcag ggagaatact gcaagttttc tcatgctcca ctgactcctg aaacacaaga attgttggct aaagttttgg atactgaaaa gaagtcatgt aataaaatag acataaaaag gtag. It is sometimes possible for the material contained within the vial of "ZC3H8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.